86. Which of the following is characteristic feature of cockroach regarding sexual dimorphism?
(1) Presence of anal styles
(2) Presence of sclerites
(3) Presence of anal cerci
(4) Dark brown body colour and anal cerci
Answer (1)
87. Select the correct statements.
A. Tetrad formation is seen during Leptotene.
B. During Anaphase, the centromeres split and chromatids separate.
C. Terminalization takes place during Pachytene.
D. Nucleolus, Golgi complex and ER are reformed during Telophase.
E. Crossing over takes place between sister chromatids of homologous chromosome.
Choose the correct answer from the options given below:
(1) B and D only
(2) A, C and E only
(3) B and E only
(4) A and C only
Answer (1)
88. Which of the following statements are correct?
A. An excessive loss of body fluid from the body switches off osmoreceptors.
B. ADH facilitates water reabsorption to prevent diuresis.
C. ANF causes vasodilation.
D. ADH causes increase in blood pressure.
E. ADH is responsible for decrease in GFR.
Choose the correct answer from the options given below:
(1) B, C and D only
(2) A, B and E only
(3) C, D and E only
(4) A and B only
Answer (1)
89. Given below are two statements:
Statement I : During G0 phase of cell cycle, the cell is metabolically inactive.
Statement II : The centrosome undergoes duplication during S phase of interphase.
In the light of the above statements, choose the most appropriate answer from the options given below:
(1) Both Statement I and Statement II are incorrect.
(2) Statement I is correct but Statement II is incorrect.
(3) Statement I is incorrect but Statement II is correct.
(4) Both Statement I and Statement II are correct
Answer (3)
90. Which one of the following is NOT an advantage of inbreeding?
(1) It exposes harmful recessive genes but are eliminated by selection.
(2) Elimination of less desirable genes and accumulation of superior genes takes place due to it.
(3) It decreases the productivity of inbred population, after continuous inbreeding.
(4) It decreases homozygosity.
Answer (3)
91. Match List I with List II.
List I List II
A. Logistic growth I. Unlimited resource availability condition
B. Exponential growth II. Limited resource availability condition
C. Expanding age pyramid III. The percent individuals of pre-reproductive age is largest followed by reproductive and post reproductive age groups
D. Stable age pyramid IV. The percent individuals of pre-reproductives and reproductive age group are same
Choose the correct answer from the options given below:
(1) A-II, B-III, C-I, D-IV
(2) A-II, B-IV, C-I, D-III
(3) A-II, B-IV, C-III, D-I
(4) A-II, B-I, C-III, D-IV
Answer (4)
92. Which of the following are NOT under the control of thyroid hormone?
A. Maintenance of water and electrolyte balance
B. Regulation of basal metabolic rate
C. Normal rhythm of sleep-wake cycle
D. Development of immune system
E. Support the process of RBCs formation
Choose the correct answer from the options given below:
(1) B and C only
(2) C and D only
(3) D and E only
(4) A and D only
Answer (2)
93. The unique mammalian characteristics are:
(1) hairs, pinna and mammary glands
(2) hairs, pinna and indirect development
(3) pinna, monocondylic skull and mammary glands
(4) hairs, tympanic membrane and mammary glands
Answer (1)
94. Which of the following statements are correct regarding skeletal muscle?
A. Muscle bundles are held together by collagenous connective tissue layer called fascicle.
B. Sarcoplasmic reticulum of muscle fibre is a store house of calcium ions.
C. Striated appearance of skeletal muscle fibre is due to distribution pattern of actin and myosin proteins.
D. M line is considered as functional unit of contraction called sarcomere.
Choose the most appropriate answer from the options given below:
(1) B and C only
(2) A, C and D only
(3) C and D only
(4) A, B and C only
Answer (1)
95. Which of the following statements are correct?
A. Basophils are most abundant cells of the total WBCs
B. Basophils secrete histamine, serotonin and heparin
C. Basophils are involved in inflammatory response
D. Basophils have kidney shaped nucleus
E. Basophils are agranulocytes
Choose the correct answer from the options given below:
(1) C and E only
(2) B and C only
(3) A and B only
(4) D and E only
Answer (2)
96. Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’?
(1) 3’ UAGCUAGCUAGCUAGCUAGCUAGCUAGC 5’
(2) 5’ ATCGATCGATCGATCGATCGATCGATCG 3’
(3) 3’ ATCGATCGATCGATCGATCGATCGATCG 5’
(4) 5’ UAGCUAGCUAGCUAGCUAGCUAGCUAGC 3’
Answer (2)
97. The parts of human brain that helps in regulation of sexual behaviour, expression of excitement, pleasure,rage, fear etc. are:
(1) Corpora quadrigemina and hippocampus
(2) Brain stem and epithalamus
(3) Corpus callosum and thalamus
(4) Limbic system and hypothalamus
Answer (4)
98. Match List I with List II.
List I List II
A. Mast cells I. Ciliated epithelium
B. Inner surface II. Areolar connective tissue Of bronchiole
C. Blood III. Cuboidal epithelium
D. Tubular parts IV. Specialised connective tissue of nephron
Choose the correct answer from the options give below:
(1) A-II, B-III, C-I, D-IV
(2) A-II, B-I, C-IV, D-III
(3) A-III, B-IV, C-II, D-I
(4) A-I, B-II, C-IV, D-III
Answer (2)
99. In cockroach, excretion is brought about by-
A. Phallic gland
B. Uricose gland
C. Nephrocytes
D. Fat body
E. Collaterial glands
(1) A, B and E only
(2) B, C and D only
(3) B and D only
(4) A and E only
Answer (2)
100. Select the correct statements with reference to chordates.
A. Presence of a mid-dorsal, solid and double nerve cord.
B. Presence of closed circulatory system.
C. Presence of paired pharyngeal gill slits.
D. Presence of dorsal heart
E. Triploblastic pseudocoelomate animals.
Choose the correct answer from the options given below:
(1) B and C only
(2) B, D and E only
(3) C, D and E only
(4) A, C and D only
Answer (1)